Review



control plenti6 3 v5 dest gfp  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    Addgene inc control plenti6 3 v5 dest gfp
    Control Plenti6 3 V5 Dest Gfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 15 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plenti6+v5+dest/pLenti6%2E3%2FV5-DEST-GFP+(Plasmid+%2340125)/pm41821016-142-13-19
    Average 93 stars, based on 15 article reviews
    control plenti6 3 v5 dest gfp - by Bioz Stars, 2026-09
    93/100 stars

    Images

    Related Articles

    Over Expression:

    Article Title: Transcriptional induction of NF-κB-inducing kinase by E2F4/5 facilitates collective invasion of GBM cells
    Article Snippet: These cell lines were maintained as spheroids in neural stem cell medium containing DMEM/F-12, 1 × B-27 supplement minus vitamin A, 1 × GlutaMAX, 25 ng/mL EGF, 25 ng/mL basic fibroblast growth factor (bFGF), and 1 × penicillin/streptomycin (Life Technologies). .. For NIK overexpression, mouse (mNIK) cDNA was cloned into pLenti6-V5-DEST (Addgene, Cambridge, MA) using the GATE-WAYTM Cloning System (Invitrogen). .. For pNIK-tagRFP, the promoter of NIK was purchased from Genecopoeia (HPRM17530) and cloned into a lentiviral plasmid.

    Article Title: Tumor necrosis factor-like weak inducer of apoptosis (TWEAK) promotes glioma cell invasion through induction of NF-κB-inducing kinase (NIK) and noncanonical NF-κB signaling
    Article Snippet: The following Santa Cruz Biotechnology (SC, Santa Cruz, CA) and Cell-Signaling Technology (CST, Danvers, MA) antibodies were used: RelB (CST-4922), RelA (SC- 8008), Phospho-RelA Ser536 (CST-3033), c-Rel (CST-4727), p100/p52 (CST-3017), p105/p50 (CST 13681), LaminA (SC 56137), IkBα (CST 4814), NIK (CST 4994), β-Actin (SC-69879). .. pLenti6 overexpression constructs for RelB and NIK were generated by subcloning cDNA into pLenti6-V5-DEST (Addgene, Cambridge, MA) using the GATEWAYTM Cloning System. .. Luciferase (Promega, Madison, WI) or tagRFP (Evrogen, Moscow, Russia) coding sequences were subcloned into pLeni6-V5-DEST and used as controls for RelB and NIK overexpression.

    Article Title: Transcriptional Induction of NF-kB-Inducing Kinase by E2F4/5 Facilitates Collective Invasion of Glioma Cells
    Article Snippet: These cell lines were maintained as spheroids in neural stem cell medium containing DMEM/F-12, 1x B27 supplement minus vitamin A, 1x GlutaMAX, 25 ng/mL EGF, 25 ng/mL basic broblast growth factor (bFGF), and 1x penicillin/streptomycin (Life Technologies). .. Plasmids For NIK overexpression, mouse (mNIK) cDNA was cloned into pLenti6-V5-DEST (Addgene, Cambridge, MA) using the GATE-WAYTM Cloning System (Invitrogen). .. For pNIK-tagRFP, the promoter of NIK was purchased from Genecopoeia (HPRM17530) and cloned into a lentiviral plasmid.

    Article Title: NIK promotes metabolic adaptation of glioblastoma cells to bioenergetic stress
    Article Snippet: .. For NIK overexpression, mouse (mNIK) cDNA was cloned into pLenti6-V5-DEST (Addgene, Cambridge, MA) using the GATE-WAY TM Cloning System (Invitrogen). .. Luciferase (Promega) coding sequences were subcloned into pLenti6-v5-DEST (Invitrogen) and served as a control vector for NIK overexpression.

    Article Title: Transcriptional induction of NF-κB-inducing kinase by E2F4/5 facilitates collective invasion of GBM cells.
    Article Snippet: .. For NIK overexpression, mouse (mNIK) cDNA was cloned into pLenti6-V5-DEST (Addgene, Cambridge, MA) using the GATE-WAYTM Cloning System (Invitrogen). .. For pNIK-tagRFP, the promoter of NIK was purchased from Genecopoeia (HPRM17530) and cloned into a lentiviral plasmid.

    Article Title: NIK regulates MT1-MMP activity and promotes glioma cell invasion independently of the canonical NF-κB pathway
    Article Snippet: .. pLenti6 overexpression constructs for NIK were generated by subcloning cDNA into pLenti6-V5-DEST (Addgene, Cambridge, MA, USA) using the GATEWAY Cloning System. .. Luciferase (Promega, Madison, WI, USA) coding sequences were subcloned into pLenti6-V5-DEST and used as controls for NIK overexpression.

    Clone Assay:

    Article Title: Transcriptional induction of NF-κB-inducing kinase by E2F4/5 facilitates collective invasion of GBM cells
    Article Snippet: These cell lines were maintained as spheroids in neural stem cell medium containing DMEM/F-12, 1 × B-27 supplement minus vitamin A, 1 × GlutaMAX, 25 ng/mL EGF, 25 ng/mL basic fibroblast growth factor (bFGF), and 1 × penicillin/streptomycin (Life Technologies). .. For NIK overexpression, mouse (mNIK) cDNA was cloned into pLenti6-V5-DEST (Addgene, Cambridge, MA) using the GATE-WAYTM Cloning System (Invitrogen). .. For pNIK-tagRFP, the promoter of NIK was purchased from Genecopoeia (HPRM17530) and cloned into a lentiviral plasmid.

    Article Title: Transcriptional Induction of NF-kB-Inducing Kinase by E2F4/5 Facilitates Collective Invasion of Glioma Cells
    Article Snippet: These cell lines were maintained as spheroids in neural stem cell medium containing DMEM/F-12, 1x B27 supplement minus vitamin A, 1x GlutaMAX, 25 ng/mL EGF, 25 ng/mL basic broblast growth factor (bFGF), and 1x penicillin/streptomycin (Life Technologies). .. Plasmids For NIK overexpression, mouse (mNIK) cDNA was cloned into pLenti6-V5-DEST (Addgene, Cambridge, MA) using the GATE-WAYTM Cloning System (Invitrogen). .. For pNIK-tagRFP, the promoter of NIK was purchased from Genecopoeia (HPRM17530) and cloned into a lentiviral plasmid.

    Article Title: NIK promotes metabolic adaptation of glioblastoma cells to bioenergetic stress
    Article Snippet: .. For NIK overexpression, mouse (mNIK) cDNA was cloned into pLenti6-V5-DEST (Addgene, Cambridge, MA) using the GATE-WAY TM Cloning System (Invitrogen). .. Luciferase (Promega) coding sequences were subcloned into pLenti6-v5-DEST (Invitrogen) and served as a control vector for NIK overexpression.

    Article Title: NIK promotes metabolic adaptation of glioblastoma cells to bioenergetic stress
    Article Snippet: .. The mutated construct was then cloned into pLenti6-V5-DEST (Addgene) using the GATE-WAYTM Cloning System (Invitrogen). .. For DRP1 S616A construct, which additionally harbors a S637E mutation, we utilized the same strategy as with 616E using following oligos: DRP1 616SA up: TATGCCAGCCGAGCCACAAAAAG, DRP1-S616SA dn: ATTGGAATGGGTTTTGATTTTTC.

    Article Title: Transcriptional induction of NF-κB-inducing kinase by E2F4/5 facilitates collective invasion of GBM cells.
    Article Snippet: .. For NIK overexpression, mouse (mNIK) cDNA was cloned into pLenti6-V5-DEST (Addgene, Cambridge, MA) using the GATE-WAYTM Cloning System (Invitrogen). .. For pNIK-tagRFP, the promoter of NIK was purchased from Genecopoeia (HPRM17530) and cloned into a lentiviral plasmid.

    Cloning:

    Article Title: Transcriptional induction of NF-κB-inducing kinase by E2F4/5 facilitates collective invasion of GBM cells
    Article Snippet: These cell lines were maintained as spheroids in neural stem cell medium containing DMEM/F-12, 1 × B-27 supplement minus vitamin A, 1 × GlutaMAX, 25 ng/mL EGF, 25 ng/mL basic fibroblast growth factor (bFGF), and 1 × penicillin/streptomycin (Life Technologies). .. For NIK overexpression, mouse (mNIK) cDNA was cloned into pLenti6-V5-DEST (Addgene, Cambridge, MA) using the GATE-WAYTM Cloning System (Invitrogen). .. For pNIK-tagRFP, the promoter of NIK was purchased from Genecopoeia (HPRM17530) and cloned into a lentiviral plasmid.

    Article Title: Tumor necrosis factor-like weak inducer of apoptosis (TWEAK) promotes glioma cell invasion through induction of NF-κB-inducing kinase (NIK) and noncanonical NF-κB signaling
    Article Snippet: The following Santa Cruz Biotechnology (SC, Santa Cruz, CA) and Cell-Signaling Technology (CST, Danvers, MA) antibodies were used: RelB (CST-4922), RelA (SC- 8008), Phospho-RelA Ser536 (CST-3033), c-Rel (CST-4727), p100/p52 (CST-3017), p105/p50 (CST 13681), LaminA (SC 56137), IkBα (CST 4814), NIK (CST 4994), β-Actin (SC-69879). .. pLenti6 overexpression constructs for RelB and NIK were generated by subcloning cDNA into pLenti6-V5-DEST (Addgene, Cambridge, MA) using the GATEWAYTM Cloning System. .. Luciferase (Promega, Madison, WI) or tagRFP (Evrogen, Moscow, Russia) coding sequences were subcloned into pLeni6-V5-DEST and used as controls for RelB and NIK overexpression.

    Article Title: Transcriptional Induction of NF-kB-Inducing Kinase by E2F4/5 Facilitates Collective Invasion of Glioma Cells
    Article Snippet: These cell lines were maintained as spheroids in neural stem cell medium containing DMEM/F-12, 1x B27 supplement minus vitamin A, 1x GlutaMAX, 25 ng/mL EGF, 25 ng/mL basic broblast growth factor (bFGF), and 1x penicillin/streptomycin (Life Technologies). .. Plasmids For NIK overexpression, mouse (mNIK) cDNA was cloned into pLenti6-V5-DEST (Addgene, Cambridge, MA) using the GATE-WAYTM Cloning System (Invitrogen). .. For pNIK-tagRFP, the promoter of NIK was purchased from Genecopoeia (HPRM17530) and cloned into a lentiviral plasmid.

    Article Title: NIK promotes metabolic adaptation of glioblastoma cells to bioenergetic stress
    Article Snippet: .. For NIK overexpression, mouse (mNIK) cDNA was cloned into pLenti6-V5-DEST (Addgene, Cambridge, MA) using the GATE-WAY TM Cloning System (Invitrogen). .. Luciferase (Promega) coding sequences were subcloned into pLenti6-v5-DEST (Invitrogen) and served as a control vector for NIK overexpression.

    Article Title: NIK promotes metabolic adaptation of glioblastoma cells to bioenergetic stress
    Article Snippet: .. The mutated construct was then cloned into pLenti6-V5-DEST (Addgene) using the GATE-WAYTM Cloning System (Invitrogen). .. For DRP1 S616A construct, which additionally harbors a S637E mutation, we utilized the same strategy as with 616E using following oligos: DRP1 616SA up: TATGCCAGCCGAGCCACAAAAAG, DRP1-S616SA dn: ATTGGAATGGGTTTTGATTTTTC.

    Article Title: Transcriptional induction of NF-κB-inducing kinase by E2F4/5 facilitates collective invasion of GBM cells.
    Article Snippet: .. For NIK overexpression, mouse (mNIK) cDNA was cloned into pLenti6-V5-DEST (Addgene, Cambridge, MA) using the GATE-WAYTM Cloning System (Invitrogen). .. For pNIK-tagRFP, the promoter of NIK was purchased from Genecopoeia (HPRM17530) and cloned into a lentiviral plasmid.

    Article Title: NIK regulates MT1-MMP activity and promotes glioma cell invasion independently of the canonical NF-κB pathway
    Article Snippet: .. pLenti6 overexpression constructs for NIK were generated by subcloning cDNA into pLenti6-V5-DEST (Addgene, Cambridge, MA, USA) using the GATEWAY Cloning System. .. Luciferase (Promega, Madison, WI, USA) coding sequences were subcloned into pLenti6-V5-DEST and used as controls for NIK overexpression.

    Construct:

    Article Title: Tumor necrosis factor-like weak inducer of apoptosis (TWEAK) promotes glioma cell invasion through induction of NF-κB-inducing kinase (NIK) and noncanonical NF-κB signaling
    Article Snippet: The following Santa Cruz Biotechnology (SC, Santa Cruz, CA) and Cell-Signaling Technology (CST, Danvers, MA) antibodies were used: RelB (CST-4922), RelA (SC- 8008), Phospho-RelA Ser536 (CST-3033), c-Rel (CST-4727), p100/p52 (CST-3017), p105/p50 (CST 13681), LaminA (SC 56137), IkBα (CST 4814), NIK (CST 4994), β-Actin (SC-69879). .. pLenti6 overexpression constructs for RelB and NIK were generated by subcloning cDNA into pLenti6-V5-DEST (Addgene, Cambridge, MA) using the GATEWAYTM Cloning System. .. Luciferase (Promega, Madison, WI) or tagRFP (Evrogen, Moscow, Russia) coding sequences were subcloned into pLeni6-V5-DEST and used as controls for RelB and NIK overexpression.

    Article Title: NIK promotes metabolic adaptation of glioblastoma cells to bioenergetic stress
    Article Snippet: .. The mutated construct was then cloned into pLenti6-V5-DEST (Addgene) using the GATE-WAYTM Cloning System (Invitrogen). .. For DRP1 S616A construct, which additionally harbors a S637E mutation, we utilized the same strategy as with 616E using following oligos: DRP1 616SA up: TATGCCAGCCGAGCCACAAAAAG, DRP1-S616SA dn: ATTGGAATGGGTTTTGATTTTTC.

    Article Title: NIK regulates MT1-MMP activity and promotes glioma cell invasion independently of the canonical NF-κB pathway
    Article Snippet: .. pLenti6 overexpression constructs for NIK were generated by subcloning cDNA into pLenti6-V5-DEST (Addgene, Cambridge, MA, USA) using the GATEWAY Cloning System. .. Luciferase (Promega, Madison, WI, USA) coding sequences were subcloned into pLenti6-V5-DEST and used as controls for NIK overexpression.

    Generated:

    Article Title: Tumor necrosis factor-like weak inducer of apoptosis (TWEAK) promotes glioma cell invasion through induction of NF-κB-inducing kinase (NIK) and noncanonical NF-κB signaling
    Article Snippet: The following Santa Cruz Biotechnology (SC, Santa Cruz, CA) and Cell-Signaling Technology (CST, Danvers, MA) antibodies were used: RelB (CST-4922), RelA (SC- 8008), Phospho-RelA Ser536 (CST-3033), c-Rel (CST-4727), p100/p52 (CST-3017), p105/p50 (CST 13681), LaminA (SC 56137), IkBα (CST 4814), NIK (CST 4994), β-Actin (SC-69879). .. pLenti6 overexpression constructs for RelB and NIK were generated by subcloning cDNA into pLenti6-V5-DEST (Addgene, Cambridge, MA) using the GATEWAYTM Cloning System. .. Luciferase (Promega, Madison, WI) or tagRFP (Evrogen, Moscow, Russia) coding sequences were subcloned into pLeni6-V5-DEST and used as controls for RelB and NIK overexpression.

    Article Title: NIK regulates MT1-MMP activity and promotes glioma cell invasion independently of the canonical NF-κB pathway
    Article Snippet: .. pLenti6 overexpression constructs for NIK were generated by subcloning cDNA into pLenti6-V5-DEST (Addgene, Cambridge, MA, USA) using the GATEWAY Cloning System. .. Luciferase (Promega, Madison, WI, USA) coding sequences were subcloned into pLenti6-V5-DEST and used as controls for NIK overexpression.

    Subcloning:

    Article Title: Tumor necrosis factor-like weak inducer of apoptosis (TWEAK) promotes glioma cell invasion through induction of NF-κB-inducing kinase (NIK) and noncanonical NF-κB signaling
    Article Snippet: The following Santa Cruz Biotechnology (SC, Santa Cruz, CA) and Cell-Signaling Technology (CST, Danvers, MA) antibodies were used: RelB (CST-4922), RelA (SC- 8008), Phospho-RelA Ser536 (CST-3033), c-Rel (CST-4727), p100/p52 (CST-3017), p105/p50 (CST 13681), LaminA (SC 56137), IkBα (CST 4814), NIK (CST 4994), β-Actin (SC-69879). .. pLenti6 overexpression constructs for RelB and NIK were generated by subcloning cDNA into pLenti6-V5-DEST (Addgene, Cambridge, MA) using the GATEWAYTM Cloning System. .. Luciferase (Promega, Madison, WI) or tagRFP (Evrogen, Moscow, Russia) coding sequences were subcloned into pLeni6-V5-DEST and used as controls for RelB and NIK overexpression.

    Article Title: NIK regulates MT1-MMP activity and promotes glioma cell invasion independently of the canonical NF-κB pathway
    Article Snippet: .. pLenti6 overexpression constructs for NIK were generated by subcloning cDNA into pLenti6-V5-DEST (Addgene, Cambridge, MA, USA) using the GATEWAY Cloning System. .. Luciferase (Promega, Madison, WI, USA) coding sequences were subcloned into pLenti6-V5-DEST and used as controls for NIK overexpression.



    Similar Products

    90
    Thermo Fisher plenti6/v5-dest
    Plenti6/V5 Dest, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plenti6+v5+dest/plenti6+v5+dest/pmc12264550-34-7-11
    Average 90 stars, based on 1 article reviews
    plenti6/v5-dest - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    93
    Addgene inc control plenti6 3 v5 dest gfp
    Control Plenti6 3 V5 Dest Gfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plenti6+v5+dest/pLenti6%2E3%2FV5-DEST-GFP+(Plasmid+%2340125)/pm41821016-142-13-19
    Average 93 stars, based on 1 article reviews
    control plenti6 3 v5 dest gfp - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc plenti6 3 gfp blastr
    Plenti6 3 Gfp Blastr, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plenti6+v5+dest/pLenti6%2E3%2FV5-DEST-GFP+(Plasmid+%2340125)/pm40739040-283-9-12
    Average 93 stars, based on 1 article reviews
    plenti6 3 gfp blastr - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc plenti6 mcm7 v5
    Plenti6 Mcm7 V5, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plenti6+v5+dest/pLenti6%2FV5-DEST-MCM7+(Plasmid+%2331212)/pmc12084625-336-12-21
    Average 93 stars, based on 1 article reviews
    plenti6 mcm7 v5 - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc plenti6 3
    Plenti6 3, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plenti6+v5+dest/pLenti6-DEST+PINK1-V5+WT+(Plasmid+%2313320)/pmc12024656-172-17-26
    Average 93 stars, based on 1 article reviews
    plenti6 3 - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc plenti v5 dest vps35 plasmid
    Fig. 2. The retromer participates in the response to mtDNA replication stress by adapting the mitochondrial morphology. (A and B) Immunostaining of HeLa cells expressing VPS29-GFP and (B) TWNKK319E-mCherry labeled with <t>α-VPS35</t> and α-TOM20. (C) Manders’ correlation coefficient between TOM20 and VPS29. n = 3, 10 images per replicate. (D to I) Western blot analysis and quantification of retromer components upon [(D) and (E)] VPS26A, [(F) and (G)] VPS29, or [(H) and (I)] VPS35 KO. α-GAPDH or α-actin was used as a loading control. GAPDH, glyceraldehyde-3-phosphate dehydrogenase. (J to L) α-TOM20 immunostaining in (J) VPS35, (K) VPS29, and (L) VPS26 KO, in the steady state and expressing TWNKK319E-mCherry. (M to O) Quantification of mitochondrial morphology parameters. n = 3, >20 cells per replicate. (P) α-TOM20 im- munostaining in VPS29 and VPS26A KO expressing TWNKK319E-mCherry and VPS35-GFP. P values were calculated using Student’s t test [(C), (E), (G), and (I)] and one-way ANOVA [(M) to (O)]. Scale bars, 10 μm. Data are presented as means ± SEM.
    Plenti V5 Dest Vps35 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plenti6+v5+dest/pLenti6%2FV5%2FDEST-VPS35+(Plasmid+%2321691)/pm40184468-317-11-15
    Average 93 stars, based on 1 article reviews
    plenti v5 dest vps35 plasmid - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc plenti6 dest pink1 v5 wt

    Plenti6 Dest Pink1 V5 Wt, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plenti6+v5+dest/pLenti6-DEST+PINK1-V5+WT+(Plasmid+%2313320)/pmc11968104-64-4-10
    Average 93 stars, based on 1 article reviews
    plenti6 dest pink1 v5 wt - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    Image Search Results


    Fig. 2. The retromer participates in the response to mtDNA replication stress by adapting the mitochondrial morphology. (A and B) Immunostaining of HeLa cells expressing VPS29-GFP and (B) TWNKK319E-mCherry labeled with α-VPS35 and α-TOM20. (C) Manders’ correlation coefficient between TOM20 and VPS29. n = 3, 10 images per replicate. (D to I) Western blot analysis and quantification of retromer components upon [(D) and (E)] VPS26A, [(F) and (G)] VPS29, or [(H) and (I)] VPS35 KO. α-GAPDH or α-actin was used as a loading control. GAPDH, glyceraldehyde-3-phosphate dehydrogenase. (J to L) α-TOM20 immunostaining in (J) VPS35, (K) VPS29, and (L) VPS26 KO, in the steady state and expressing TWNKK319E-mCherry. (M to O) Quantification of mitochondrial morphology parameters. n = 3, >20 cells per replicate. (P) α-TOM20 im- munostaining in VPS29 and VPS26A KO expressing TWNKK319E-mCherry and VPS35-GFP. P values were calculated using Student’s t test [(C), (E), (G), and (I)] and one-way ANOVA [(M) to (O)]. Scale bars, 10 μm. Data are presented as means ± SEM.

    Journal: Science advances

    Article Title: Retromer promotes the lysosomal turnover of mtDNA.

    doi: 10.1126/sciadv.adr6415

    Figure Lengend Snippet: Fig. 2. The retromer participates in the response to mtDNA replication stress by adapting the mitochondrial morphology. (A and B) Immunostaining of HeLa cells expressing VPS29-GFP and (B) TWNKK319E-mCherry labeled with α-VPS35 and α-TOM20. (C) Manders’ correlation coefficient between TOM20 and VPS29. n = 3, 10 images per replicate. (D to I) Western blot analysis and quantification of retromer components upon [(D) and (E)] VPS26A, [(F) and (G)] VPS29, or [(H) and (I)] VPS35 KO. α-GAPDH or α-actin was used as a loading control. GAPDH, glyceraldehyde-3-phosphate dehydrogenase. (J to L) α-TOM20 immunostaining in (J) VPS35, (K) VPS29, and (L) VPS26 KO, in the steady state and expressing TWNKK319E-mCherry. (M to O) Quantification of mitochondrial morphology parameters. n = 3, >20 cells per replicate. (P) α-TOM20 im- munostaining in VPS29 and VPS26A KO expressing TWNKK319E-mCherry and VPS35-GFP. P values were calculated using Student’s t test [(C), (E), (G), and (I)] and one-way ANOVA [(M) to (O)]. Scale bars, 10 μm. Data are presented as means ± SEM.

    Article Snippet: VPS35- EGFP and VPS35- CFP were generated by subcloning VPS35 from pLenti/V5/ DEST- VPS35 plasmid (Addgene #21691) in pEGFP- N1 and pECFP- N1 plasmid using Xho I and Bam HI sites.

    Techniques: Immunostaining, Expressing, Labeling, Western Blot, Control

    Fig. 3. mtDNA replication stress and oxidation initiate the release of mitochondrial components. (A) HeLa cells expressing VPS35-GFP and TWNKK319E-mCherry and labeled with the mitochondrial outer membrane marker α-TOM20 and mitochondrial matrix α-PDH. (B to D) Quantification of α-TOM20− and α-PDH+ foci [(B) and (C)] in control cells expressing the indicated plasmids and (D) in retromer deficient cells. n = 3, >15 cells per replicate. (E) Immunostaining of VPS29 KO cells expressing TWNKK319E-mCherry and labeled with α-TOM20− and α-PDH+ foci. (F) Fluorescence profile of 50-pixel line. The selected area is highlighted above the graph. (G and H) Immunostaining of α-TOM20 and α-PDH in cells treated with (G) 200 μM H2O2 4 hours or (H) grown in galactose medium overnight. (I) Quantification of α-TOM20− and α-PDH+ foci in H2O2 and galactose- treated cells. Where indicated, cells were treated with 10 μM chloroquine 4 hours before fixation to block lysosomal function (n = 3, >15 cells per replicate). TOM20−/PDH+ foci are encircled in magenta circles. P values were calculated using one-way ANOVA with Tukey correction for multiple comparisons. Scale bars, 10 μm. Data are presented as means ± SEM.

    Journal: Science advances

    Article Title: Retromer promotes the lysosomal turnover of mtDNA.

    doi: 10.1126/sciadv.adr6415

    Figure Lengend Snippet: Fig. 3. mtDNA replication stress and oxidation initiate the release of mitochondrial components. (A) HeLa cells expressing VPS35-GFP and TWNKK319E-mCherry and labeled with the mitochondrial outer membrane marker α-TOM20 and mitochondrial matrix α-PDH. (B to D) Quantification of α-TOM20− and α-PDH+ foci [(B) and (C)] in control cells expressing the indicated plasmids and (D) in retromer deficient cells. n = 3, >15 cells per replicate. (E) Immunostaining of VPS29 KO cells expressing TWNKK319E-mCherry and labeled with α-TOM20− and α-PDH+ foci. (F) Fluorescence profile of 50-pixel line. The selected area is highlighted above the graph. (G and H) Immunostaining of α-TOM20 and α-PDH in cells treated with (G) 200 μM H2O2 4 hours or (H) grown in galactose medium overnight. (I) Quantification of α-TOM20− and α-PDH+ foci in H2O2 and galactose- treated cells. Where indicated, cells were treated with 10 μM chloroquine 4 hours before fixation to block lysosomal function (n = 3, >15 cells per replicate). TOM20−/PDH+ foci are encircled in magenta circles. P values were calculated using one-way ANOVA with Tukey correction for multiple comparisons. Scale bars, 10 μm. Data are presented as means ± SEM.

    Article Snippet: VPS35- EGFP and VPS35- CFP were generated by subcloning VPS35 from pLenti/V5/ DEST- VPS35 plasmid (Addgene #21691) in pEGFP- N1 and pECFP- N1 plasmid using Xho I and Bam HI sites.

    Techniques: Expressing, Labeling, Membrane, Marker, Control, Immunostaining, Fluorescence, Blocking Assay

    Fig. 4. mtDNA replication stress triggers Bax-dependent mtDNA release. (A) HeLa cells expressing TWNKK319E-mCherry and VPS35-GFP labeled with α-TOM20 and α-dsDNA or α-PDH. (B) Fluorescence profile of 50-pixel line labeled in (A). (C) qPCR quantification of ND1 and ND5 mtDNA genes in mitochondria-free cytosolic fractions (n = 3). (D to G) Analysis and quantification of cytosolic dsDNA foci upon mtDNA replication stress by immunostaining with α-TOM20 and α-dsDNA in [(D) and (E)] VPS35- GFP expressing cells and [(F) and (G)] Miro1 KO cells. (n = 3, >15 cells per replicate). (H) HeLa cells expressing mtDNA-Kaede and TWNKK319E-mCherry labeled with α-TOM20 and α-PDH. (I) Quantification of TOM20- Vesicles containing PDH, dsDNA or both (n = 3, >20 cells per replicate). (J and K) Analysis and quantification of the involvement of mitochondrial membrane pores in mtDNA release. Where indicated, 24 hours after transfection, cells were further treated 4 hours with 10 μM chloroquine, 25 μM VBIT- 12 for VDAC1 inhibition, or 100 μM V5 peptide for the inhibition of BAX oligomerization (n = 3, >15 cells per replicate). TOM20−/PDH+ foci are encircled by magenta cir- cles. TOM20−/dsDNA+ and TOM20−/mtDNA-Kaede+ foci are encircled by magenta circles. DMSO, dimethyl sulfoxide. P values were calculated using one-way ANOVA with Tukey correction for multiple comparisons [(C), (E), and (I)] and Student’s t test [(G) and (K)]. Scale bars, 10 μm, except for (H), 5 μm. Data are presented as means ± SEM.

    Journal: Science advances

    Article Title: Retromer promotes the lysosomal turnover of mtDNA.

    doi: 10.1126/sciadv.adr6415

    Figure Lengend Snippet: Fig. 4. mtDNA replication stress triggers Bax-dependent mtDNA release. (A) HeLa cells expressing TWNKK319E-mCherry and VPS35-GFP labeled with α-TOM20 and α-dsDNA or α-PDH. (B) Fluorescence profile of 50-pixel line labeled in (A). (C) qPCR quantification of ND1 and ND5 mtDNA genes in mitochondria-free cytosolic fractions (n = 3). (D to G) Analysis and quantification of cytosolic dsDNA foci upon mtDNA replication stress by immunostaining with α-TOM20 and α-dsDNA in [(D) and (E)] VPS35- GFP expressing cells and [(F) and (G)] Miro1 KO cells. (n = 3, >15 cells per replicate). (H) HeLa cells expressing mtDNA-Kaede and TWNKK319E-mCherry labeled with α-TOM20 and α-PDH. (I) Quantification of TOM20- Vesicles containing PDH, dsDNA or both (n = 3, >20 cells per replicate). (J and K) Analysis and quantification of the involvement of mitochondrial membrane pores in mtDNA release. Where indicated, 24 hours after transfection, cells were further treated 4 hours with 10 μM chloroquine, 25 μM VBIT- 12 for VDAC1 inhibition, or 100 μM V5 peptide for the inhibition of BAX oligomerization (n = 3, >15 cells per replicate). TOM20−/PDH+ foci are encircled by magenta cir- cles. TOM20−/dsDNA+ and TOM20−/mtDNA-Kaede+ foci are encircled by magenta circles. DMSO, dimethyl sulfoxide. P values were calculated using one-way ANOVA with Tukey correction for multiple comparisons [(C), (E), and (I)] and Student’s t test [(G) and (K)]. Scale bars, 10 μm, except for (H), 5 μm. Data are presented as means ± SEM.

    Article Snippet: VPS35- EGFP and VPS35- CFP were generated by subcloning VPS35 from pLenti/V5/ DEST- VPS35 plasmid (Addgene #21691) in pEGFP- N1 and pECFP- N1 plasmid using Xho I and Bam HI sites.

    Techniques: Expressing, Labeling, Fluorescence, Immunostaining, Membrane, Transfection, Inhibition

    Fig. 5. mtDNA release occurs through direct transfer to a recycling organelle. (A) CLEM of cells expressing TWNKK319E-mCherry and labeled with SYBR Gold and PK MitoDeep Red. Boxes labeled with (a) and (b) indicate the areas used for CLEM. (B and C) Volumetric reconstitution of electron tomographies of cytosolic mtDNA areas. The organelle containing dsDNA is shown in green, other recycling organelles in lilac, mitochondrial outer membrane in gray, and mitochondrial cristae in cyan. (D) TWNKK319E-mCherry cell further expressing VPS35-CFP. Boxes labeled with (c) and (d) indicate the areas used for CLEM. (E and F) Correlation of VPS35-CFP foci and (F) mtDNA exit site. (G and H) Volumetric reconstitution of electron tomographies in VPS35-CFP cells. In all cases, cells were treated with 10 μM chloroquine for 4 hours. For CLEM, all dyes were loaded for 1 hour before fixation. Scale bars, 500 nm for reconstituted tomograms [(B), (C), (G), and (H)], 1 μm [(E) and (F)], and 10 μm [(A) and (D)].

    Journal: Science advances

    Article Title: Retromer promotes the lysosomal turnover of mtDNA.

    doi: 10.1126/sciadv.adr6415

    Figure Lengend Snippet: Fig. 5. mtDNA release occurs through direct transfer to a recycling organelle. (A) CLEM of cells expressing TWNKK319E-mCherry and labeled with SYBR Gold and PK MitoDeep Red. Boxes labeled with (a) and (b) indicate the areas used for CLEM. (B and C) Volumetric reconstitution of electron tomographies of cytosolic mtDNA areas. The organelle containing dsDNA is shown in green, other recycling organelles in lilac, mitochondrial outer membrane in gray, and mitochondrial cristae in cyan. (D) TWNKK319E-mCherry cell further expressing VPS35-CFP. Boxes labeled with (c) and (d) indicate the areas used for CLEM. (E and F) Correlation of VPS35-CFP foci and (F) mtDNA exit site. (G and H) Volumetric reconstitution of electron tomographies in VPS35-CFP cells. In all cases, cells were treated with 10 μM chloroquine for 4 hours. For CLEM, all dyes were loaded for 1 hour before fixation. Scale bars, 500 nm for reconstituted tomograms [(B), (C), (G), and (H)], 1 μm [(E) and (F)], and 10 μm [(A) and (D)].

    Article Snippet: VPS35- EGFP and VPS35- CFP were generated by subcloning VPS35 from pLenti/V5/ DEST- VPS35 plasmid (Addgene #21691) in pEGFP- N1 and pECFP- N1 plasmid using Xho I and Bam HI sites.

    Techniques: Expressing, Labeling, Membrane

    Fig. 6. The small GTPase RAB10 promotes mitochondrial fragmentation and mtDNA degradation in lysosomes. (A) Immunostaining of HeLa cells expressing the constitutive active protein RAB10Q68L-GFP labeled with α-VPS35. (B) Manders’ correlation coefficient between RAB10 and VPS35. (C and D) Confocal images of cells ex- pressing WT RAB10-GFP, constitutive active RAB10Q68L-GFP, dominant negative RAB10T23N-GFP, in the steady state, and (D) expressing TWNKK319E-mCherry, labeled with α-TOM20. (E) Quantification of the mitochondrial morphology in RAB10 expressing cells (n = 3, >20 cells per replicate). (F and G) Cells expressing RAB10Q68L-GFP and (G) TWNKK319E-mCherry labeled with α-LAMP1 and α-dsDNA. Arrows depict RAB10-LAMP1-dsDNA foci. (H) Manders’ correlation coefficient between RAB10-GFP and LAMP1 and LAMP1 and dsDNA (n = 3, 10 images per replicate). (I) RAB10-GFP coimmunoprecipitation in the steady state and cells expressing TWNKK319E-mCherry with the lysosomal protein LAMP1. P values were calculated using one-way ANOVA with Tukey correction for multiple comparisons. Scale bars, 10 μm. Data are presented as means ± SEM.

    Journal: Science advances

    Article Title: Retromer promotes the lysosomal turnover of mtDNA.

    doi: 10.1126/sciadv.adr6415

    Figure Lengend Snippet: Fig. 6. The small GTPase RAB10 promotes mitochondrial fragmentation and mtDNA degradation in lysosomes. (A) Immunostaining of HeLa cells expressing the constitutive active protein RAB10Q68L-GFP labeled with α-VPS35. (B) Manders’ correlation coefficient between RAB10 and VPS35. (C and D) Confocal images of cells ex- pressing WT RAB10-GFP, constitutive active RAB10Q68L-GFP, dominant negative RAB10T23N-GFP, in the steady state, and (D) expressing TWNKK319E-mCherry, labeled with α-TOM20. (E) Quantification of the mitochondrial morphology in RAB10 expressing cells (n = 3, >20 cells per replicate). (F and G) Cells expressing RAB10Q68L-GFP and (G) TWNKK319E-mCherry labeled with α-LAMP1 and α-dsDNA. Arrows depict RAB10-LAMP1-dsDNA foci. (H) Manders’ correlation coefficient between RAB10-GFP and LAMP1 and LAMP1 and dsDNA (n = 3, 10 images per replicate). (I) RAB10-GFP coimmunoprecipitation in the steady state and cells expressing TWNKK319E-mCherry with the lysosomal protein LAMP1. P values were calculated using one-way ANOVA with Tukey correction for multiple comparisons. Scale bars, 10 μm. Data are presented as means ± SEM.

    Article Snippet: VPS35- EGFP and VPS35- CFP were generated by subcloning VPS35 from pLenti/V5/ DEST- VPS35 plasmid (Addgene #21691) in pEGFP- N1 and pECFP- N1 plasmid using Xho I and Bam HI sites.

    Techniques: Immunostaining, Expressing, Labeling, Dominant Negative Mutation

    Fig. 7. VPS35 overexpression recovers mtDNA homoplasmy in Drosophila. (A) Schematic representation of the approach to generate mtDNA deletion covering 2564 bp in larval epidermis. The restriction enzyme Afl III and the T4-DNA ligase directed to mitochondria were both expressed under the UAS promotor. A-58 Gal4 was used to drive the expression of the transgenes in the larval epidermis. WT, wild-type mtDNA. Illustration from NIAID NIH BIOART Source. (B) Bright-field images of transgenic L3 larvae used in this study. (C) CytB/ND5 ratio showing mtDNA heteroplasmy obtained by qPCR from total DNA extracts of L3 larvae (Control, n = 8; Epi-ΔmtDNA, n = 9). (D) mtDNA copy number quantification using ND5 gene and TUBB as a mitochondrial and nuclear gene, respectively (n = 9). (E and F) Western blot analysis (E) and quan- tification (F) of total protein extracts of L3 larvae for SDHB and ATPA. Ponceau S (Ps) was used as a loading control (Control, n = 3; Epi-ΔmtDNA, n = 4). (G and H) mtDNA copy number (G) and mtDNA heteroplasmy quantification (H) upon genetic manipulations (Control, n = 9; Epi-ΔmtDNA, n = 9; Epi-ΔmtDNA-Vps35OE, n = 9). (I) Electron microscopy images of larval epidermis. Mitochondria were pseudocolored in yellow and lysosomes in blue (dark content). Control refers to the A58Gal4/+ genotype (B) and specific UAS control in other quantifications. P values were calculated using the Student’s t test [(C), (D), and (F)] and one-way ANOVA with Tukey correction for multiple comparisons [(G) and (H)]. Scale bars, 1 mm (B) and 500 nm (I). Data are presented as means ± SEM.

    Journal: Science advances

    Article Title: Retromer promotes the lysosomal turnover of mtDNA.

    doi: 10.1126/sciadv.adr6415

    Figure Lengend Snippet: Fig. 7. VPS35 overexpression recovers mtDNA homoplasmy in Drosophila. (A) Schematic representation of the approach to generate mtDNA deletion covering 2564 bp in larval epidermis. The restriction enzyme Afl III and the T4-DNA ligase directed to mitochondria were both expressed under the UAS promotor. A-58 Gal4 was used to drive the expression of the transgenes in the larval epidermis. WT, wild-type mtDNA. Illustration from NIAID NIH BIOART Source. (B) Bright-field images of transgenic L3 larvae used in this study. (C) CytB/ND5 ratio showing mtDNA heteroplasmy obtained by qPCR from total DNA extracts of L3 larvae (Control, n = 8; Epi-ΔmtDNA, n = 9). (D) mtDNA copy number quantification using ND5 gene and TUBB as a mitochondrial and nuclear gene, respectively (n = 9). (E and F) Western blot analysis (E) and quan- tification (F) of total protein extracts of L3 larvae for SDHB and ATPA. Ponceau S (Ps) was used as a loading control (Control, n = 3; Epi-ΔmtDNA, n = 4). (G and H) mtDNA copy number (G) and mtDNA heteroplasmy quantification (H) upon genetic manipulations (Control, n = 9; Epi-ΔmtDNA, n = 9; Epi-ΔmtDNA-Vps35OE, n = 9). (I) Electron microscopy images of larval epidermis. Mitochondria were pseudocolored in yellow and lysosomes in blue (dark content). Control refers to the A58Gal4/+ genotype (B) and specific UAS control in other quantifications. P values were calculated using the Student’s t test [(C), (D), and (F)] and one-way ANOVA with Tukey correction for multiple comparisons [(G) and (H)]. Scale bars, 1 mm (B) and 500 nm (I). Data are presented as means ± SEM.

    Article Snippet: VPS35- EGFP and VPS35- CFP were generated by subcloning VPS35 from pLenti/V5/ DEST- VPS35 plasmid (Addgene #21691) in pEGFP- N1 and pECFP- N1 plasmid using Xho I and Bam HI sites.

    Techniques: Over Expression, Expressing, Transgenic Assay, Control, Western Blot, Electron Microscopy

    Fig. 8. VPS35 expression restores mitochondrial defects associated with ΔmtDNA. (A) Venn diagram for genes differentially expressed (FDR of 5%) between control and Epi-ΔmtDNA shared through four differential expression methods (Limma-voom, EdgeR-QLF, EdgeR_LRT, and DESeq2) (n = 4 per genotype). (B) DAVID pathway enrichment analysis for genes differentially expressed. (C) Heatmap for log FC showing gene identities for the top four categories of differentially enriched pathways. (D) mRNA quantification of selected genes in Epi-ΔmtDNA and Epi-ΔmtDNA-Vps35OE larvae (n = 4 per genotype). Control refers to the A58-Gal4/+ genotype. P values were calculated using one-way ANOVA with Tukey correction for multiple comparisons. Data are presented as means ± SEM.

    Journal: Science advances

    Article Title: Retromer promotes the lysosomal turnover of mtDNA.

    doi: 10.1126/sciadv.adr6415

    Figure Lengend Snippet: Fig. 8. VPS35 expression restores mitochondrial defects associated with ΔmtDNA. (A) Venn diagram for genes differentially expressed (FDR of 5%) between control and Epi-ΔmtDNA shared through four differential expression methods (Limma-voom, EdgeR-QLF, EdgeR_LRT, and DESeq2) (n = 4 per genotype). (B) DAVID pathway enrichment analysis for genes differentially expressed. (C) Heatmap for log FC showing gene identities for the top four categories of differentially enriched pathways. (D) mRNA quantification of selected genes in Epi-ΔmtDNA and Epi-ΔmtDNA-Vps35OE larvae (n = 4 per genotype). Control refers to the A58-Gal4/+ genotype. P values were calculated using one-way ANOVA with Tukey correction for multiple comparisons. Data are presented as means ± SEM.

    Article Snippet: VPS35- EGFP and VPS35- CFP were generated by subcloning VPS35 from pLenti/V5/ DEST- VPS35 plasmid (Addgene #21691) in pEGFP- N1 and pECFP- N1 plasmid using Xho I and Bam HI sites.

    Techniques: Expressing, Control, Quantitative Proteomics

    Fig. 9. Proposed model for retromer function upon mtDNA stress. The retromer enhances mitochondrial fragmentation and mtDNA turnover. mtDNA ejection occurs in a BAX-dependent manner, targeting RAB10-VPS35-positive lysosomes, and independent of MDVs. Stimulation of these pathways restores mitochondrial function and mitigates defects associated with mtDNA damage in vivo.

    Journal: Science advances

    Article Title: Retromer promotes the lysosomal turnover of mtDNA.

    doi: 10.1126/sciadv.adr6415

    Figure Lengend Snippet: Fig. 9. Proposed model for retromer function upon mtDNA stress. The retromer enhances mitochondrial fragmentation and mtDNA turnover. mtDNA ejection occurs in a BAX-dependent manner, targeting RAB10-VPS35-positive lysosomes, and independent of MDVs. Stimulation of these pathways restores mitochondrial function and mitigates defects associated with mtDNA damage in vivo.

    Article Snippet: VPS35- EGFP and VPS35- CFP were generated by subcloning VPS35 from pLenti/V5/ DEST- VPS35 plasmid (Addgene #21691) in pEGFP- N1 and pECFP- N1 plasmid using Xho I and Bam HI sites.

    Techniques: In Vivo

    Journal: eLife

    Article Title: Synaptic deregulation of cholinergic projection neurons causes olfactory dysfunction across five fly Parkinsonism models

    doi: 10.7554/eLife.98348

    Figure Lengend Snippet:

    Article Snippet: Recombinant DNA reagent , pLenti6-DEST PINK1-V5 WT , , RRID: Addgene_13320 , .

    Techniques: Knock-Out, Knock-In, Control, Mutagenesis, Transfection, Construct, Plasmid Preparation, Expressing, Imaging, Recombinant, Sequencing, Multiplex Assay, Software